ISO/TS 20224-11:2024
(Main)Molecular biomarker analysis — Detection of animal-derived materials in foodstuffs and feedstuffs by real-time PCR — Part 11: Pigeon DNA detection method
Molecular biomarker analysis — Detection of animal-derived materials in foodstuffs and feedstuffs by real-time PCR — Part 11: Pigeon DNA detection method
This document specifies a real-time polymerase chain reaction (real-time PCR) method for the qualitative detection of pigeon-specific DNA derived from food and feed. The method can be applied to distinguish rock pigeon (Columba livia) from other domestic poultry meats (e. g. goose, duck, quail, pheasant). It requires the extraction of an adequate amount of PCR amplifiable DNA from the relevant matrix. The target sequence is a partial fragment of Columba livia breed Danish Tumbler unplaced genomic scaffold, Cliv_1.0 scaffold114 (i.e. GenBank accession number NW_004973337.1),[1] which is present as a single copy per haploid genome. The provided PCR assay for this target has an absolute limit of detection of five copies per reaction, with ≥ 95 % confidence at this concentration (LOD95 %).
Analyse de biomarqueurs moléculaires — Détection de matériaux d'origine animale dans les denrées alimentaires et les aliments pour animaux par PCR en temps réel — Partie 11: Méthode de détection de l'ADN de pigeon
General Information
- Status
- Published
- Publication Date
- 18-Feb-2024
- Technical Committee
- ISO/TC 34/SC 16 - Horizontal methods for molecular biomarker analysis
- Drafting Committee
- ISO/TC 34/SC 16 - Horizontal methods for molecular biomarker analysis
- Current Stage
- 6060 - International Standard published
- Start Date
- 19-Feb-2024
- Due Date
- 10-May-2025
- Completion Date
- 19-Feb-2024
Overview
ISO/TS 20224-11:2024 specifies a standardized method for the qualitative detection of pigeon-specific DNA in foodstuffs and feedstuffs using real-time polymerase chain reaction (real-time PCR). Developed by the International Organization for Standardization (ISO), this technical specification enables laboratories to identify the presence of material derived from rock pigeon (Columba livia) with high sensitivity and specificity. The method is intended to distinguish pigeon DNA from other domestic poultry meats, such as goose, duck, quail, and pheasant, through a molecular biomarker approach.
This standard supports regulatory compliance, quality assurance, and food authenticity testing in the global food and feed industry.
Key Topics
- Detection Principle: Utilizes real-time PCR to amplify and detect a partial fragment of the Columba livia unplaced genomic scaffold (GenBank accession NW_004973337.1), which is unique to the pigeon genome.
- Qualitative Analysis: The method identifies the presence or absence of pigeon DNA, supporting verification of food ingredient authenticity.
- Sensitivity: Achieves an absolute detection limit as low as five copies per PCR reaction with at least 95% confidence (LOD95%).
- Specificity: Validated against a broad range of animal and plant species to ensure exclusive detection of pigeon DNA with no cross-reactivity.
- Sample Requirements: Effective DNA extraction from a representative, homogenized test portion is critical for accurate results.
- Controls and Validation: Incorporates positive/negative controls and reference gene assays for reliable performance. Demonstrated robust reproducibility and accuracy in international collaborative trials.
Applications
DNA Detection in Food and Feed
- Food Fraud Prevention: Supports authorities and producers in detecting adulteration or mislabeling of poultry products, protecting consumers and upholding food regulations.
- Compliance and Labeling: Assists manufacturers in verifying claims about the absence or presence of specific animal species, ensuring transparency in labeling.
- Feed Ingredient Authentication: Confirms the species origin of animal-derived materials used in animal feeds, critical for quality control and ethical sourcing.
- Halal, Kosher, and Ethnological Diets: Facilitates verification of compliance with dietary restrictions by ensuring traceability of animal species content.
- Trade and Import/Export Verification: Equipped for official control laboratories to check compliance with international trade standards for meat products and feeds.
Laboratory Workflow
- DNA is extracted using validated protocols.
- PCR is set up with pigeon-specific primers and probes, following prescribed concentrations and conditions.
- Real-time PCR thermocyclers are used to analyze fluorescence signals, establishing presence/absence calls.
- Control assays ensure quality and reliability, with retesting and replication processes outlined for borderline cases.
Related Standards
- ISO 16577: Vocabulary for molecular biomarker analytical methods in agriculture and food production.
- ISO 20813: General requirements and definitions for animal species detection and identification in foods by nucleic acid-based methods.
- ISO 21571: Methods and requirements for the extraction of nucleic acids from foodstuffs.
- ISO 24276: General requirements for detection of genetically modified organisms and derived products.
- ISO/TS 16393: Guidance on the use of probability of detection (POD) in PCR-based methods.
These related standards provide foundational concepts, harmonized terminology, and methodological consistency for molecular biomarker analysis, supporting the broader ISO 20224 series on DNA detection of specific animal species in food and feed.
Practical Value
Implementing ISO/TS 20224-11:2024 assures stakeholders of reliable, standardized detection of pigeon-derived material in their products, strengthening food safety controls, promoting trust in supply chains, and meeting regulatory requirements. Laboratories and food businesses can benefit from internationally agreed protocols that reduce the risks associated with food fraud, mislabeling, and undeclared allergenic or restricted substances. The adoption of this standard brings greater confidence and integrity to the food industry.
Get Certified
Connect with accredited certification bodies for this standard

BSI Group
BSI (British Standards Institution) is the business standards company that helps organizations make excellence a habit.

Bureau Veritas
Bureau Veritas is a world leader in laboratory testing, inspection and certification services.

DNV
DNV is an independent assurance and risk management provider.
Sponsored listings
Frequently Asked Questions
ISO/TS 20224-11:2024 is a technical specification published by the International Organization for Standardization (ISO). Its full title is "Molecular biomarker analysis — Detection of animal-derived materials in foodstuffs and feedstuffs by real-time PCR — Part 11: Pigeon DNA detection method". This standard covers: This document specifies a real-time polymerase chain reaction (real-time PCR) method for the qualitative detection of pigeon-specific DNA derived from food and feed. The method can be applied to distinguish rock pigeon (Columba livia) from other domestic poultry meats (e. g. goose, duck, quail, pheasant). It requires the extraction of an adequate amount of PCR amplifiable DNA from the relevant matrix. The target sequence is a partial fragment of Columba livia breed Danish Tumbler unplaced genomic scaffold, Cliv_1.0 scaffold114 (i.e. GenBank accession number NW_004973337.1),[1] which is present as a single copy per haploid genome. The provided PCR assay for this target has an absolute limit of detection of five copies per reaction, with ≥ 95 % confidence at this concentration (LOD95 %).
This document specifies a real-time polymerase chain reaction (real-time PCR) method for the qualitative detection of pigeon-specific DNA derived from food and feed. The method can be applied to distinguish rock pigeon (Columba livia) from other domestic poultry meats (e. g. goose, duck, quail, pheasant). It requires the extraction of an adequate amount of PCR amplifiable DNA from the relevant matrix. The target sequence is a partial fragment of Columba livia breed Danish Tumbler unplaced genomic scaffold, Cliv_1.0 scaffold114 (i.e. GenBank accession number NW_004973337.1),[1] which is present as a single copy per haploid genome. The provided PCR assay for this target has an absolute limit of detection of five copies per reaction, with ≥ 95 % confidence at this concentration (LOD95 %).
ISO/TS 20224-11:2024 is classified under the following ICS (International Classification for Standards) categories: 67.050 - General methods of tests and analysis for food products. The ICS classification helps identify the subject area and facilitates finding related standards.
ISO/TS 20224-11:2024 is available in PDF format for immediate download after purchase. The document can be added to your cart and obtained through the secure checkout process. Digital delivery ensures instant access to the complete standard document.
Standards Content (Sample)
Technical
Specification
ISO/TS 20224-11
First edition
Molecular biomarker analysis —
2024-02
Detection of animal-derived
materials in foodstuffs and
feedstuffs by real-time PCR —
Part 11:
Pigeon DNA detection method
Analyse de biomarqueurs moléculaires — Détection de matériaux
d'origine animale dans les denrées alimentaires et les aliments
pour animaux par PCR en temps réel —
Partie 11: Méthode de détection de l'ADN de pigeon
Reference number
© ISO 2024
All rights reserved. Unless otherwise specified, or required in the context of its implementation, no part of this publication may
be reproduced or utilized otherwise in any form or by any means, electronic or mechanical, including photocopying, or posting on
the internet or an intranet, without prior written permission. Permission can be requested from either ISO at the address below
or ISO’s member body in the country of the requester.
ISO copyright office
CP 401 • Ch. de Blandonnet 8
CH-1214 Vernier, Geneva
Phone: +41 22 749 01 11
Email: copyright@iso.org
Website: www.iso.org
Published in Switzerland
ii
Contents Page
Foreword .iv
Introduction .v
1 Scope . 1
2 Normative references . 1
3 Terms and definitions . 1
4 Scientific basis . 2
5 Reagents and materials . 2
5.1 General .2
5.2 PCR reagents .2
5.2.1 PCR master mix. .2
5.2.2 Oligonucleotides. .2
6 Apparatus . 3
6.1 Real-time thermocycler instrument. .3
7 Procedure . 3
7.1 Preparation of the test portion/sample .3
7.2 Preparation of DNA extracts .3
7.3 PCR setup.3
7.3.1 Reaction mixes .3
7.3.2 PCR controls .4
7.3.3 Real-time PCR thermocycler plate set-up.4
7.4 Temperature-time programme.4
8 Accept/reject criteria . 5
8.1 General .5
8.2 Identification .5
9 Validation status and performance criteria . 5
9.1 General .5
9.2 Robustness .5
9.3 Reproducibility .6
9.4 Sensitivity .6
9.5 Specificity .9
10 Test report .11
Annex A (informative) BlastN +2.12.0 results for query of GenBank RefSeq genome (refseq_
genomes) and whole-genome shotgun contigs (wgs) .12
Annex B (informative) Members of the Columbidae family and its family tree established with
available public genomic sequences . 14
Bibliography .24
iii
Foreword
ISO (the International Organization for Standardization) is a worldwide federation of national standards
bodies (ISO member bodies). The work of preparing International Standards is normally carried out through
ISO technical committees. Each member body interested in a subject for which a technical committee
has been established has the right to be represented on that committee. International organizations,
governmental and non-governmental, in liaison with ISO, also take part in the work. ISO collaborates closely
with the International Electrotechnical Commission (IEC) on all matters of electrotechnical standardization.
The procedures used to develop this document and those intended for its further maintenance are described
in the ISO/IEC Directives, Part 1. In particular, the different approval criteria needed for the different types
of ISO document should be noted. This document was drafted in accordance with the editorial rules of the
ISO/IEC Directives, Part 2 (see www.iso.org/directives).
ISO draws attention to the possibility that the implementation of this document may involve the use of (a)
patent(s). ISO takes no position concerning the evidence, validity or applicability of any claimed patent
rights in respect thereof. As of the date of publication of this document, ISO had not received notice of (a)
patent(s) which may be required to implement this document. However, implementers are cautioned that
this may not represent the latest information, which may be obtained from the patent database available at
www.iso.org/patents. ISO shall not be held responsible for identifying any or all such patent rights.
Any trade name used in this document is information given for the convenience of users and does not
constitute an endorsement.
For an explanation of the voluntary nature of standards, the meaning of ISO specific terms and expressions
related to conformity assessment, as well as information about ISO's adherence to the World Trade
Organization (WTO) principles in the Technical Barriers to Trade (TBT), see www.iso.org/iso/foreword.html.
This document was prepared by Technical Committee ISO/TC 34, Food products, Subcommittee SC 16,
Horizontal methods for molecular biomarker analysis.
A list of all parts in the ISO 20224 series can be found on the ISO website.
Any feedback or questions on this document should be directed to the user’s national standards body. A
complete listing of these bodies can be found at www.iso.org/members.html.
iv
Introduction
Fraudulent adulteration of meat in food and feed threatens both public safety and commerce. Adulteration
can affect those adhering to ethnological dietary rules, economic development and social stability. This
document provides a real-time polymerase chain reaction (real-time PCR) analytical method for the
identification of meat animal species from nucleic acid present in the ingredients of food and feed.
Animal-derived biological materials in food and feed are detected and identified in the laboratory with the
following successive (or simultaneous) steps: preparation of the test portion/sample, nucleic acid extraction
and purification, PCR amplification and interpretation of results. This document provides guidance for PCR
amplification and interpretation of results, specific to rock pigeon (Columba livia) DNA detection.
The ISO 20224 series consists of technical specifications that describe specific applications. New species
DNA detection methods established in the future will be added as independent parts.
v
Technical Specification ISO/TS 20224-11:2024(en)
Molecular biomarker analysis — Detection of animal-derived
materials in foodstuffs and feedstuffs by real-time PCR —
Part 11:
Pigeon DNA detection method
1 Scope
This document specifies a real-time polymerase chain reaction (real-time PCR) method for the qualitative
detection of pigeon-specific DNA derived from food and feed. The method can be applied to distinguish rock
pigeon (Columba livia) from other domestic poultry meats (e. g. goose, duck, quail, pheasant). It requires the
extraction of an adequate amount of PCR amplifiable DNA from the relevant matrix.
The target sequence is a partial fragment of Columba livia breed Danish Tumbler unplaced genomic scaffold,
[1]
Cliv_1.0 scaffold114 (i.e. GenBank accession number NW_004973337.1), which is present as a single copy
per haploid genome. The provided PCR assay for this target has an absolute limit of detection of five copies
per reaction, with ≥ 95 % confidence at this concentration (LOD ).
95 %
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content constitutes
requirements of this document. For dated references, only the edition cited applies. For undated references,
the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Vocabulary for molecular biomarker analytical methods in
agriculture and food production
ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of animal
species in foods and food products (nucleic acid-based methods) — General requirements and definitions
ISO 21571, Foodstuffs — Methods of analysis for the detection of genetically modified organisms and derived
products — Nucleic acid extraction
ISO 24276, Foodstuffs — Methods of analysis for the detection of genetically modified organisms and derived
products — General requirements and definitions
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 apply.
ISO and IEC maintain terminology databases for use in standardization at the following addresses:
— ISO Online browsing platform: available at https:// www .iso .org/ obp
— IEC Electropedia: available at https:// www .electropedia .org/
4 Scientific basis
DNA is extracted from the test portion by applying a suitable method (see ISO 21571:2005, A.1). The DNA
analysis consists of two parts:
— verification of the quality and amplifiability of the extracted DNA using a PCR assay specific for eukaryotes
(i.e. 18S rRNA gene) or mammals and poultry (i.e. myostatin gene);
— detection of the pigeon species-specific DNA sequence of the single-copy Columba livia unplaced genomic
scaffold sequence (i.e. GenBank accession number NW_004973337.1) in a real-time PCR.
NOTE The copy number of the eukaryotic ribosomal 18S RNA (18S rRNA) gene in a cell varies from several hundred
to several thousand, while the specific target sequence in the pigeon genome and myostatin gene in mammals and
poultry genome are single copy. The copy number of the specific target sequence in the pigeon genome was confirmed
by bioinformatics analysis at the whole genome scale (see Annex A) and digital PCR for absolute quantification.
5 Reagents and materials
5.1 General
For this document, only reagents and water of recognized analytical grade, appropriate for molecular
biology, shall be used. Unless stated otherwise, solutions should be prepared by dissolving the corresponding
reagents in water followed by autoclave sterilization. For all operations in which gloves are used, gloves
shall be powder free. The use of aerosol protected pipette tips (protection against cross-contamination) is
recommended.
5.2 PCR reagents
5.2.1 PCR master mix.
In general, real-time PCR master mix contains thermostable DNA polymerase, dNTPs, MgCl , KCl, and buffer
as a dilutable concentrated mixture, that is ready to use.
5.2.2 Oligonucleotides.
The quality of the oligonucleotides shall be sufficient for their use as primers and probes. See Table 1.
Table 1 — Oligonucleotides
Final concentration
Name DNA sequence of the oligonucleotide
in PCR
a
Specific sequence in Columba livia unplaced genomic scaffold sequence (i.e. GenBank accession number NW_004973337.1)
Pigeon-113bp-F 5′- GCAGTTGTTTAGTCCTCCTGTAAC -3′ 400 nmol/l
Pigeon-113bp-R 5′- GGGCTAACATCAAGACGCAAAG -3′ 400 nmol/l
b
Pigeon-113bp-P 5′- [FAM]- CGGACTCCTAAGAGCACTTCTCAGCCTGG -[TAMRA] -3′ 200 nmol/l
a
PCR product = 3 716 744 - GCAGTTGTTT AGTCCTCCTG TAACACGGAC TCCTAAGAGC ACTTCTCAGC CTGGCTTTGT
TTTCGTCACA CTGTGTATCT GAACCGCCGT TCTTTGCGTC TTGATGTTAG CCC – 3 716 856 - NW_004973337.1
b
FAM: 6-carboxyfluorescein, TAMRA: 6-carboxytetramethylrhodamine.
Pigeon-113bp-F is base pairs 3 716 744 – 3 716 767, Pigeon-113bp-R is base pairs 3 716 835 – 3 716 856 and
Pigeon-113bp-P is 3 716 769 – 3 716 797 of NW_004973337.1, pigeon unplaced genomic scaffold sequence.
Equivalent reporter dyes and/or quencher dyes can be used if they yield the same or better results.
6 Apparatus
Requirements concerning apparatus and materials shall follow ISO 20813. In addition to the usual laboratory
equipment, the following equipment is required.
6.1 Real-time thermocycler instrument.
A device that amplifies DNA in vitro and performs the temperature-time cycles that are needed for PCR.
Additionally, the device shall be capable of exciting fluorescence molecules at specific wavelengths and
detecting sufficient emitted fluorescent light of the fluorophore used to perform TaqMan format assays.
7 Procedure
7.1 Preparation of the test portion/sample
The test sample used for DNA extraction shall be representative of the laboratory sample and homogeneous,
e.g. by grinding or homogenizing the laboratory sample to a fine mixture. Test portion/sample preparation
shall follow the general requirements and specific methods described in ISO 21571 and ISO 20813.
7.2 Preparation of DNA extracts
The extraction/purification and quantification of DNA from the test portion shall follow the general
requirements and methods provided in ISO 21571. DNA extraction methods described in ISO 21571: 2005,
Annex A, are recommended.
7.3 PCR setup
7.3.1 Reaction mixes
The method is for a total volume of 25 μl per PCR. The reaction setup is given in Table 2. Reagents shall
be completely thawed at room temperature. Each reagent shall be carefully mixed and briefly centrifuged
immediately before pipetting. A PCR reagent mixture is prepared to contain all components except for the
sample DNA. The required total amount of the PCR reagent mixture prepared depends on the number of
reactions to be performed, including at least one additional reaction as a pipetting reserve. The number of
sample and control replicates shall follow ISO 20813. Set up the PCR tests as follows:
a) mix the PCR reagent mixture, centrifuge briefly and pipette 20 µl into each reaction vial;
b) add 5 µl of each sample DNA or positive DNA target control or extraction blank control or water to the
respective reaction vials;
c) mix and centrifuge briefly.
Table 2 — Reaction setup for the amplification
Total reaction volume 25 µl
a
Sample DNA or controls 5 µl
b
2 × PCR master mix 12,5 µl
Primer Pigeon-113bp-F, c = 10 μmol/l and Pigeon-113bp-R, c = 10 μmol/l 1,0 µl for each
Probe Pigeon-113bp-P, c = 10 μmol/l 0,5 µl
Water to 25 µl
a
The amount of DNA in one reaction can be up to 200 ng, but the recommendation amount is less than 200 ng per reaction.
b
In the collaborative trial, a ready-to-use optimized 2 × PCR master mix containing all of the components, excluding the
template and primers, was used. The 2 × PCR master mix contains thermostable DNA polymerase, a blend of dNTPs with dUTP
and uracil-UDG to minimize carry-over PCR contamination, and a passive internal reference based on ROX dye. Equivalent
products can be used if they yield the same or better results. If necessary, the amounts of the reagents and the temperature-time
programme can be adapted.
7.3.2 PCR controls
7.3.2.1 General
PCR controls shall be as described in ISO 24276 and ISO 20813.
7.3.2.2 Inhibition control (reference gene assay)
A reference control gene (i.e. 18S rRNA gene for eukaryotes, myostatin gene for mammals and poultry) PCR
assay using sample DNAs shall be performed to test nucleic acid amplifiability and provide control to exclude
false-negative results.
7.3.3 Real-time PCR thermocycler plate set-up
Transfer the setup reaction vials to the thermocycler. The vials should be arranged to avoid any possible
edge temperature variations associated with a particular real-time thermocycler instrument. Start the
temperature-time programme.
7.4 Temperature-time programme
The temperature-time programme as outlined in Table 3 was used in the validation study. The use of
different reaction conditions and real-time PCR cycles shall be verified. The time for initial denaturation
depends on the master mix used.
Table 3 — Temperature-time programme
Step Parameter Temperature Time Fluorescence meas- Cycles
urement
a
1 UNG activation 50 °C 2 min no 1
2 Initial denaturation 95 °C 10 min no 1
Denaturation 95 °C 15 s no
3 Amplification 45
Annealing and
60 °C 60 s yes
elongation
a UNG (Uracil-N-Glycosylase) activation is mandatory if UDG-glycosylase is included in mastermix and optional if UDG-
glycosylase is not included in mastermix.
8 Accept/reject criteria
8.1 General
A corresponding real-time PCR-instrument-specific data analysis programme shall be used for the
identification of PCR products. The amplification results can be expressed differently, depending on the
instrument used. In the absence of detectable PCR products (e.g. negative controls), the result shall be
expressed as “undetermined”, “no amplification” or the maximum number of reaction cycles performed. If
amplification of the DNA target sequence in a sample (e.g. positive controls) occurred, a sigmoid-shaped
amplification curve shall be observed. The cycle number at the crossing point of the amplification curve and
the fluorescence threshold shall be calculated [cycle threshold (C ) or cycle quantification (C )].
t q
If, due to atypical fluorescence measurement data, the automatic interpretation does not provide a
meaningful result, it may be necessary to set the baseline and the threshold manually prior to interpreting
the data. In such a case, the device-specific instructions provided with the interpretation software shall be
followed.
8.2 Identification
The target sequence is considered as detected if:
— pigeon-specific primers Pigeon-113bp-F and Pigeon-113bp-R and the probe Pigeon-113bp-P, produce a
sigmoid-shaped amplification curve and a C value or C value ≤LOD can be calculated;
t q 95 %
— PCR control reactions with no added DNA (PCR reagent control, extraction blank control) produce no
amplification;
— the amplification controls (positive DNA target control, PCR inhibition control) produce the expected
amplification and C values (or C values).
t q
Trace detections are
...




Questions, Comments and Discussion
Ask us and Technical Secretary will try to provide an answer. You can facilitate discussion about the standard in here.
Loading comments...